Volume 20, Issue 1 (Winter & Spring 2023)                   ASJ 2023, 20(1): 7-14 | Back to browse issues page

XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Taheri A, Gholami M, Bazgir B, Abednatanzi H. The Effects of High-intensity Interval Training and Moderate-intensity Continuous Training on Autophagy, Cardiac Remodeling, and Heart Function in Aged Male Rats. ASJ 2023; 20 (1) :7-14
URL: http://anatomyjournal.ir/article-1-611-en.html
1- Department of Exercise Physiology, Faculty of Literature, Science and Research Branch, Islamic Azad University, Tehran, Iran.
2- Department of Physical Education and Sport Sciences, Faculty of Literature, Humanities and Social Sciences, Science and Research Branch, Islamic Azad University, Tehran, Iran.
3- Exercise Physiology Research Center, Life Style Institute, Baqiyatallah University of Medical Sciences, Tehran, Iran.
4- Department of Professional Physical Education and Sport Science, Faculty of Literature, Science and Research Branch, Islamic Azad University, Tehran, Iran.
Full-Text [PDF 877 kb]   (704 Downloads)     |   Abstract (HTML)  (3567 Views)
Full-Text:   (1935 Views)
Introduction
The cardiovascular system undergoes physiological changes with the increase of age, affecting cardiac function. One of the most notable effects is the gradual decline in the heart’s ability to pump blood efficiently, known as age-related diastolic dysfunction. This occurs due to the alterations in the structure and function of cardiac muscles and associated connective tissues. These changes can lead to decreased ventricular compliance, impairing the heart’s ability to relax and fill with blood during diastole [1]. Additionally, the conduction system of the heart may experience age-related changes, which can lead to arrhythmias and altered heart rate control. The accumulation of oxidative stress and inflammation over time can further exacerbate these effects, potentially contributing to the onset of cardiovascular conditions like heart failure and hypertension in older individuals [2]. Regular exercise, a heart-healthy diet, and appropriate medical management can play crucial roles in mitigating the impact of aging on cardiac function. High-intensity interval training (HIIT) is a form of exercise characterized by brief, intense bursts of activity alternated with rest periods or low-intensity exercise.
It seems that HIIT can effectively improve the cardiovascular system. HIIT is also a time-efficient workout option, as it can be completed in 10-30 min [3]. Moderate-intensity continuous training (MICT) also involves maintaining a steady pace of moderate intensity for a prolonged period. MICT has been shown to improve cardiovascular health, increase endurance, and aid in weight loss [4]. The mammalian target of rapamycin complex 1 (mTORC1) is involved in several cellular functions such as protein synthesis, autophagy, and metabolism.
In the heart, mTORC1 is essential for controlling cardiac function and growth. Activation of mTORC1 in cardiac myocytes promotes protein synthesis and hypertrophy, which can lead to cardiac dysfunction and heart failure. Additionally, mTORC1 is involved in regulating mitochondrial function and energy metabolism in the heart. Dysregulation of mTORC1 signaling has been linked to different heart conditions, such as ischemia-reperfusion injury, cardiomyopathy, and heart failure [5]. Atg16 is a key regulator of autophagy, a process where cells dismantle and reuse damaged or unneeded parts. Autophagy is crucial for maintaining heart function and protecting against various stressors. Research indicates that Atg16 expression increases in response to cardiac stress, including ischemia-reperfusion injury or pressure overload. This upregulation of Atg16 promotes autophagy and protects against cardiac dysfunction and heart failure. Conversely, downregulation of Atg16 has been linked to impaired autophagy and increased susceptibility to cardiac injury [6]. Atg7 is another essential gene involved in the regulation of autophagy. Like Atg16, Atg7 expression is upregulated in response to cardiac stress and plays a crucial role in safeguarding against cardiovascular conditions. Studies have shown that Atg7 deficiency in the heart leads to impaired autophagy and increased susceptibility to cardiac injury [7]. The collagen type 3 (COLIII) gene is known to play a crucial role in the maintenance of cardiac function. Collagen is a structural protein that provides support and elasticity to the heart tissue. Decreased expression of COLIII has been linked to impaired cardiac contractility, while increased expression has been associated with fibrosis and stiffening of the heart muscle [8]. Left ventricular end-diastolic diameter (LVEDD), left ventricular end-systolic diameter (LVESD), ejection fraction (EF), and fractional shortening (FS) are important cardiac indices that are used to assess cardiac function. LVEDD and LVESD measure the size of the left ventricle at the end of diastole and systole, respectively, indicating the level of chamber dilation or hypertrophy. EF measures the percentage of blood ejected from the left ventricle, while FS is the percentage of changes in the left ventricle’s diameter during systole compared to diastole. Together, these indices provide valuable information about the contractile function of the heart and can help diagnose and monitor various cardiac diseases, such as heart failure, myocardial infarction, and cardiomyopathy [9].
According to the abovementioned explanations, the authors aimed to assess the impact of HIIT and MICT on improving heart function by examining gene pathways of mTORC1, autophagy (Atg16 and Atg7), collagen disposition (COLIII), and cardiac function indicators (LVEDD, LVESD, EF, and FS). 

Materials and Methods
Animal preparation and ethical consideration

This experimental investigation was conducted on 24 old (≈20 months) Wistar male rats with an average weight of 350±50 g (obtained from Pasteur Institute, Tehran, Iran). The research animals included three groups of control, MICT, and HIIT. The prepared animals were transferred to the laboratory of Iran University of Medical Sciences. All stages of animal manipulation and ethical issues were conducted according to the guidelines set forth by the ethics committee for conducting research with laboratory animals. The animals were housed individually in transparent polyethylene cages. Standard conditions for laboratory animals were prepared as 23-25 oC, 45-50% humidity, and 12 light/12 dark photocycle. Free access to standard pellets and water is also provided. The animals’ weights were fully documented before the experiment and tissue sampling [10]. 

Training protocols of HIIT and MICT
The training groups were organized into two groups of HIIT and MICT. Besides, the control group received no training. Treadmilling was set at a slow speed of 3 m/min. Each group performed the associated protocol five days per week (for eight weeks). On the sixth day, the maximum oxygen consumption (VO2max) was measured. The day of seven was also defined for animal recovery [11]. MICT protocol included 5 min of body warming-up with the intensity of 30-40% VO2max, 30 min of running with the intensity of 60-65% VO2max, and 5 min of body cooling-down with the intensity of 30-40% VO2max. The HIIT protocol consisted of 30 min of running on a treadmill with eight different intervals in each session, which included (a) five minutes of warming-up at an intensity of 30-40% VO2max, (b) three minutes at an intensity of 85-90% VO2max with two minutes of rest at an intensity of 30-35% VO2max between each interval. In the first weeks, the intense intervals were applied at 85% VO2max; (c) five minutes of cooling-down at an intensity of 30-40% VO2max. The training intensity for each week was adjusted and determined based on running speed, and the training intensity increased by 0.02 m/s every week [12].

Aerobic power and training capacity assessment
The training capacity test was performed in two stages, each for two days, before the main training program and at the end of each week. After three minutes of body warming-up (5 m/min), the treadmill speed was increased to 4 m/min every two minutes. The maximum speed was defined when the rats could not run at a constant speed for at least 90 seconds (treadmill incline was 0 o). According to the published studies, the maximum speed with a lactate concentration >6 mMOL/L and breathing ratio of VCO2/VO2 was equal to 1.5 [12].

Two-dimensional echocardiography
24 h after the last training, two-dimensional (2D) chest-connected echocardiography was performed (M-mode model, GE-VIVID-7, V.5, USA) equipped with the 10 MHz transducer. Following anesthesia induction using IP injection of sodium thiopental (30 mg/kg), various cardiac-associated indices were measured, including right ventricle thickness, internal dimensions of the ventricle, thickness of interventricular septum, internal dimensions of the left ventricle (LV) during systole (LVESD) and diastole (LVEDD), and thickness of the posterior wall of left ventricular. Also, ejection fraction (EF) and shortening fraction (SF) of cardiac muscle were estimated [13].

Tissue sampling
Two days following the final training session and following overnight fasting, the animals were anesthetized by 50 IU Injection of ketamine into the peritoneal cavity (90 mg/kg) and xylazine (10 mg/kg). Thoracotomy was applied, and the heart tissue was dissected. Then, the left ventricle cardiac tissue was cut and stored in liquid nitrogen [14]. 

Genes expression assessment 
In this study, the qRT-PCR technique was used for gene expression assessment. The mRNA samples of the left ventricular (50 mg) were extracted (RNA solution kit) and treated with DNase I. cDNA was made (Transe Criptor first strand cDNA synthesis kit, Germany), and qRT-PCR reactions were performed. The absorption ratio of 260/280 ng was 1-2.8 for all extracted samples. Electrophoresis and 1% agarose gel were used to check the quality of extracted RNA. Finally, gene expression levels were quantified using the Ct (2-ΔΔt) method (fold changes). The assessed genes were mTORC1 (F: GAAGCCACAGCAGAAGAACC, R: ACGACCATGTTCTACCAGGC) [15], Atg16 (F: GCCCAGTTGAGGATCAAACAC, R: CTGCTGCATTTGGTTGTTCAG) [16], Atg7 (F: ATTGTGGCTCCTGCCCCAGT, R: GAGGACAGAGACCATCAGCTCCAC) [17], and COLIII (F: AGCTGGCCTTCCTC, R: GCTGTTTTTGCAG) [18].

Statistical analysis
The normality of the extracted data was assessed using the Shapiro-Wilk test. To identify group differences, one-way analysis of variance (ANOVA) and Tukey’s post hoc test were used at a significance level of 0.05. Data analysis was applied using SPSS software, version 19, and the figures were drawn by Graph Pad Prism software, version 8 [19].

Results
Following the assessment of the total body weight, no significant (p<0.05) alteration was detected regarding the body weight among the treatments (MICT and HIIT) and control groups (Table 1).


According to the findings, the gene expression of mTORC1 was increased significantly (p<0.05) in HIIT and MICT groups compared to control animals. Also, HIIT showed significantly higher levels of mTORC1 gene expression than the MICT group (p<0.05) (Figure 1A).

The Atg16 gene expression was significantly accelerated in HIIT and MICT groups compared to control animals (p<0.05). It was also found that the gene expression of MICT was accelerated significantly (p<0.05) compared to the HIIT group (Figure 1B). The gene expression of Atg7 was increased significantly (p<0.05) in HIIT and MICT groups that control animals. Also, it was found that Atg7 gene expression was significantly higher in the HIIT group than in the MICT group (p<0.05) (Figure 1C). The COLIII gene expression was significantly lower in the MICT and HIIT groups than in control animals (p<0.05). According to the findings, HIIT was not significantly higher compared to the MICT group (p>0.05) (Figure 1D). Since the figures represented, the LVEDD (Figure 2A) and LVESD (Figure 2B) were decreased significantly (p<0.05) in HIIT and MICT groups than control animals.

Also, LVESD and LVEDD showed significantly lower levels in the MICT group than in the HIIT group (p<0.05). The EF (Figure 2C) and SF (Figure 2D) indicators were increased significantly in both groups of MICT and HIIT groups than in control animals (p<0.05). The HIIT group had significantly higher levels than the MICT group (p<0.05).

Discussion 
The findings showed no body weight differences in the treatment groups compared to the control animals. Also, LVEDD and LVESD were decreased in the MICT and HIIT groups. Besides, the training accelerated EF and FS indices. These changes were highlighted in the HIIT group than in the MICT group. Gene expression assessment of mTORC1, Atg16, and Atg7 also showed higher levels in the HIIT and MICT groups and lower levels in the COLIII gene. Aging is associated with changes in the cardiovascular system affecting cardiac function. Some of these changes are normal and occur with age, while others are due to modifiable factors and can lead to heart disease. The impact of aging on the cardiovascular system can be observed across molecular, cellular, tissue, organ, and systemic levels. Aging-related structural alterations affect the myocardium, cardiac conduction system, and endocardium. Age-related structural changes, particularly affecting the contractility of the left ventricular wall, have a significant impact. The heart’s pumping efficiency decreases with age due to various factors. Aging notably affects both the heart and arteries, contributing to increased cardiovascular diseases such as atherosclerosis, hypertension, and heart failure. However, lifestyle factors, including physical activity, can influence the aging process of the heart and arteries, potentially slowing its progression in healthy individuals. Exercise training has been shown to have a positive effect on cardiac function. Regular physical activity reduces resting heart rate, blood pressure, and markers associated with atherosclerosis while promoting physiological cardiac hypertrophy.
Exercise enhances myocardial blood flow and raises high-density lipoprotein (HDL) cholesterol levels, collectively easing strain on the heart and improving cardiovascular function in both healthy individuals and those with medical conditions. A systematic review comprising 63 studies revealed that exercise-focused cardiac rehabilitation enhanced cardiovascular function. These studies encompassed diverse forms of aerobic exercise spanning various intensities and durations [20]. Research has demonstrated that the mTORC1 genetic pathway is involved in regulating cardiac function. Experiments using mTOR loss-of-function models have shown that activating mTORC1 is essential for developing adaptive cardiac hypertrophy [21]. The mTOR pathway, particularly mTORC1, has been shown to control aging, lifespan, and healthspan by regulating cardiac function. It is widely recognized that mTORC1 is crucial for stimulating protein synthesis, lipid metabolism, mitochondrial biogenesis, and nucleotide synthesis, and other cellular processes. In cardiac tissue, mTORC1 has been shown to regulate protein synthesis and autophagy, which are important for maintaining cardiac function. Exercise training has been shown to activate the mTORC1 genetic pathway, leading to increased protein synthesis and skeletal muscle mass. However, the effect of exercise training on the mTORC1 pathway in cardiac tissue is less clear. Further research is needed to determine the impact of exercise training on the mTORC1 pathway in cardiac tissue and its potential role in regulating cardiac function. Autophagy is a cellular mechanism essential for maintaining cellular balance by breaking down and recycling damaged organelles and proteins.
Exercise has been shown to affect autophagy gene expression, with some studies suggesting that HIIT and MICT can activate autophagy in skeletal muscle and other tissues [22-24]. However, the effect of HIIT and MICT on autophagy gene expression in cardiac tissue is less clear. Some studies suggest that HIIT can activate autophagy in the myocardium, while others suggest that HIIT can disable autophagy, apoptosis, and atrophy pathways [2526]. One study found that HIIT led to cellular process improvement by promoting autophagy, while another study found that HIIT inhibited autophagy [27]. The observed inconsistency in exercise effects could be due to the condition of examined subjects, the duration and intensity of the exercise, and the methods used to measure autophagy gene expression. Further research is needed to determine the effect of HIIT and MICT on autophagy gene expression in cardiac tissue and its potential role in regulating cardiac function. Collagen type III deposition in cardiac tissue is an important factor in the aging process and considerably affects cardiac function. Collagen type III deposition in cardiac tissue increases with age, leading to fibrosis and stiffening of the myocardium. Increased collagen deposition and fibrosis have been associated with stiffening of the myocardium, as well as dysfunction in both diastole and systole, and altered structure and function of the heart [28]. Collagen type I and collagen type III provide structural support for muscle cells and are critical for cardiac function. The production and breakdown of collagen, a key structural protein, are influenced by a complex interplay of biochemical mediators, ischemia, stretching, and other factors [29]. The cardiac extracellular matrix (ECM), primarily made up of fibrillar collagen, helps maintain myocardial integrity, facilitates force transmission, and is crucial for preserving cardiac structural integrity [30]. Collagen type III deposition in cardiac tissue can lead to fibrotic remodeling, which can contribute to the development of heart failure [31]. Understanding the role of collagen type III deposition in cardiac tissue in aging animals is important for developing treatments for age-related cardiac dysfunction. More investigation is required to understand how collagen type III is deposited in the heart tissue of older animals and how this affects their cardiac function.
The role of HIIT and MICT on cardiac function can be assessed using 2-dimensional echocardiography features such as LVEDD, LVESD, EF, and FS. A study on patients early after ST-segment elevation myocardial infarction (STEMI) found that HIIT was not different from isocaloric MICT with regard toregarding the short-term effects on LVEDVi and LVESVi [32]. There is limited evidence regarding the impact of HIIT on heart failure with preserved ejection fraction (HFpEF), as most studies examining HIIT in heart failure have predominantly concentrated on heart failure with reduced ejection fraction. (HFrEF) [33]. A meta-analysis of randomized controlled trials concluded that HIIT was superior to MICT in enhancing left ventricular ejection fraction (LVEF) among patients with coronary artery disease (CAD) [34]. Another study demonstrated that HIIT was more effective than MICT in enhancing physical performance and promoting cardiac and skeletal muscle adaptations in a rat model [24]. A randomized controlled trial found that an optimized HIIT protocol was significantly superior to classical interval training in improving heart rate variability in chronic heart failure patients [35]. The findings suggest that HIIT may positively affect cardiac function, particularly in improving LVEF and physical performance. However, more research is needed to determine the long-term effects of HIIT and MICT on cardiac function and their potential role in preventing or treating cardiovascular disease.

Conclusion
The results of the current study revealed that the training can effectively accelerate autophagy-associated gene expression and mTORC1 molecular pathway. Also, collagen III deposition was a determining factor that decreased after cardiac tissue training. It seems that the cardiac function indicators, including LVEDD and LVESD, decreased, while EF and FS increased, representing higher levels of cardiac output in old age. The findings of the current study suggest that HIIT is more effective for cardiac function and cardiac output than MICT. Thus, HIIT for older adults’ heart seems to be a precise research topic in future studies. 

Ethical Considerations
Compliance with ethical guidelines

All stages of animal manipulation and ethical issues were conducted according to the guidelines set forth by the Ethics Committee of Islamic Azad University (Ethic Code: IR.IAU.SRB.REC.1400.191).

Funding
This research did not receive any grant from funding agencies in the public, commercial, or non-profit sectors.

Authors' contributions
Conceptualization and Supervision: Mandana Gholami; Methodology: Mandana Gholami; Investigation, Writing – original draft, and Writing – review & editing: All authors; Data collection: Azadeh Taheri; Data analysis: Azadeh Taheri and Hossein Abednatanzi; Funding acquisition and Resources: Mandana Gholami, and Azadeh Taheri. 

Conflict of interest
The authors declared no conflict of interest.


References
  1. Li H, Hastings MH, Rhee J, Trager LE, Roh JD, Rosenzweig A. Targeting age-related pathways in heart failure. Circulation Research. 2020; 126(4):533-51. [DOI:10.1161/CIRCRESAHA.119.315889] [PMID]
  2. Steven S, Frenis K, Oelze M, Kalinovic S, Kuntic M, Bayo Jimenez MT, et al. Vascular inflammation and oxidative stress: Major triggers for cardiovascular disease. Oxidative Medicine and Cellular Longevity. 2019; 2019:7092151. [DOI:10.1155/2019/7092151] [PMID]
  3. Elboim-Gabyzon M, Buxbaum R, Klein R. The effects of high-intensity interval training (HIIT) on fall risk factors in healthy older adults: A systematic review. International Journal of Environmental Research and Public Health. 2021; 18(22):11809. [DOI:10.3390/ijerph182211809] [PMID]
  4. O'Brien MW, Johns JA, Robinson SA, Bungay A, Mekary S, Kimmerly DS. Impact of high-intensity interval training, moderate-intensity continuous training, and resistance training on endothelial function in older adults. Medicine and Science in Sports and Exercise. 2020; 52(5):1057-67. [DOI:10.1249/MSS.0000000000002226] [PMID]
  5. Sanches-Silva A, Testai L, Nabavi SF, Battino M, Pandima Devi K, Tejada S, et al. Therapeutic potential of polyphenols in cardiovascular diseases: Regulation of mTOR signaling pathway. Pharmacological Research. 2020; 152:104626. [DOI:10.1016/j.phrs.2019.104626] [PMID]
  6. Ajoolabady A, Aslkhodapasandhokmabad H, Aghanejad A, Zhang Y, Ren J. Mitophagy receptors and mediators: therapeutic targets in the management of cardiovascular ageing. Ageing Research Reviews. 2020; 62:101129. [DOI:10.1016/j.arr.2020.101129] [PMID]
  7. Sarosh M, Nurulain SM, Shah STA, Jadoon Khan M, Muneer Z, Bibi N, et al. Association analysis of single nucleotide polymorphisms in autophagy related 7 (ATG7) gene in patients with coronary artery disease. Medicine. 2022; 101(26):e29776. [DOI:10.1097/MD.0000000000029776] [PMID]
  8. Zhong X, Qian X, Chen G, Song X. The role of galectin-3 in heart failure and cardiovascular disease. Clinical and Experimental Pharmacology & Physiology. 2019; 46(3):197-203. [DOI:10.1111/1440-1681.13048] [PMID]
  9. Branca L, Sbolli M, Metra M, Fudim M. Heart failure with mid-range ejection fraction: Pro and cons of the new classification of Heart Failure by European Society of Cardiology guidelines. ESC Heart Failure. 2020; 7(2):381-99. [DOI:10.1002/ehf2.12586] [PMID]
  10. Ghanbari A, Jalili C, Abdolmaleki A, Zhaleh M, Zarinkhat A, Akhshi N. Falcaria vulgaris L. hydroalcoholic extract protects against harmful effects of mercuric chloride on the rat kidney. Avicenna Journal of Phytomedicine. 2023; 13(4):442-53. [PMID] [PMCID]
  11. Høydal MA, Wisløff U, Kemi OJ, Ellingsen O. Running speed and maximal oxygen uptake in rats and mice: Practical implications for exercise training. European Journal of Cardiovascular Prevention and Rehabilitation. 2007; 14(6):753-60. [DOI:10.1097/HJR.0b013e3281eacef1] [PMID]
  12. Kraljevic J, Marinovic J, Pravdic D, Zubin P, Dujic Z, Wisloff U, et al. Aerobic interval training attenuates remodelling and mitochondrial dysfunction in the post-infarction failing rat heart. Cardiovascular Research. 2013; 99(1):55-64. [DOI:10.1093/cvr/cvt080] [PMID]
  13. Park SH, Shub C, Nobrega TP, Bailey KR, Seward JB. Two-dimensional echocardiographic calculation of left ventricular mass as recommended by the American Society of Echocardiography: Correlation with autopsy and M-mode echocardiography. Journal of the American Society of Echocardiography. 1996; 9(2):119-28. [DOI:10.1016/S0894-7317(96)90019-X] [PMID]
  14. Roshankhah S, Taghadosi M, Abdolmaleki A, Ziapour A, Salahshoor MR. Effect of thymus vulgaris extract against toxic effects of diabetes on the coronary heart angiogenesis of rats. Journal of Clinical & Diagnostic Research. 2020;14(2):CF01-4. [DOI:10.7860/JCDR/2020/43499.13517]
  1. Sengupta S, Peterson TR, Laplante M, Oh S, Sabatini DM. mTORC1 controls fasting-induced ketogenesis and its modulation by ageing. Nature. 2010; 468(7327):1100-4. [DOI:10.1038/nature09584] [PMID]
  2. Yu Y, Ma T, Lv L, Jia L, Ruan H, Chen H, et al. Oleanolic acid targets the regulation of PI3K/AKT/mTOR pathway and activates autophagy in chondrocytes to improve osteoarthritis in rats. Journal of Functional Foods. 2022; 94:105144. [DOI:10.1016/j.jff.2022.105144]
  3. Chen X, Qin W, Wang L, Jin Y, Tu J, Yuan X. Autophagy gene Atg7 regulates the development of radiation-induced skin injury and fibrosis of skin. Skin Research and Technology. 2023; 29(6):e13337. [DOI:10.1111/srt.13337] [PMID]
  4. Kelloniemi A, Aro J, Näpänkangas J, Koivisto E, Mustonen E, Ruskoaho H, et al. TSC-22 up-regulates collagen 3a1 gene expression in the rat heart. BMC Cardiovascular Disorders. 2015; 15:122. [DOI:10.1186/s12872-015-0121-2] [PMID]
  5. Shabanizadeh A, Roshankhah S, Abdolmaleki A, Salahshoor MR. Applications of sumach extract in reduction of male reproductive parameters damages following morphine administration through down-regulated apoptotic genes, antioxidants regulation, and inflammatory markers suppression. European Journal of Anatomy. 2022; 26(1):43-55. [DOI:10.52083/OFOO2669]
  6. Pinckard K, Baskin KK, Stanford KI. Effects of exercise to improve cardiovascular health. Frontiers in Cardiovascular Medicine. 2019; 6:69. [DOI:10.3389/fcvm.2019.00069] [PMID]
  7. Sciarretta S, Forte M, Frati G, Sadoshima J. New insights into the role of mTOR signaling in the cardiovascular system. Circulation Research. 2018; 122(3):489-505. [DOI:10.1161/CIRCRESAHA.117.311147] [PMID]
  8. Escobar KA, Welch AM, Wells A, Fennel Z, Nava R, Li Z, et al. Autophagy response to acute high-intensity interval training and moderate-intensity continuous training is dissimilar in skeletal muscle and peripheral blood mononuclear cells and is influenced by sex. Human Nutrition & Metabolism. 2021; 23:200118. [DOI:10.1016/j.hnm.2020.200118]
  9. Escobar KA. Autophagy is stimulated by acute high intensity interval exercise in human skeletal muscle and electrical pulse stimulation in C2C12 myotubes in vitro [Doctoral Dissertation]. Albuquerque: University of New Mexico; 2018. [Link]
  10. Li FH, Li T, Ai JY, Sun L, Min Z, Duan R, et al. Beneficial autophagic activities, mitochondrial function, and metabolic phenotype adaptations promoted by high-intensity interval training in a rat model. Frontiers in Physiology. 2018; 9:571. [DOI:10.3389/fphys.2018.00571] [PMID]
  11. Daryanoosh F, Moghadam MS, Pahlavani HA, Bahmanbeglou NA, Mirzaei S. The effect of high-intensity interval training (HIIT) on the expression of proteins involved in autophagy, apoptosis, and atrophy pathways in the myocardium of male rats with type 2 diabetes. 2022; [Unpublished]. [DOI:10.21203/rs.3.rs-2105962/v1]
  12. Sadeghi S, Delphan M, Shams M, Esmaeili F, Shanaki-Bavarsad M, Shanaki M. The high-intensity interval training (HIIT) and curcumin supplementation can positively regulate the autophagy pathway in myocardial cells of STZ-induced diabetic rats. BMC Research Notes. 2023; 16(1):21. [DOI:10.1186/s13104-023-06295-1] [PMID]
  13. Rami M, Ahmadi Hekmatikar A, Rahdar S, Marashi SS, Daud DM. Highlighting the effects of high-intensity interval training on the changes associated with hypertrophy, apoptosis, and histological proteins of the heart of old rats with type 2 diabetes. Scientific Reports. 2024; 14(1):7133. [PMID]
  14. Horn MA, Trafford AW. Aging and the cardiac collagen matrix: Novel mediators of fibrotic remodelling. Journal of Molecular and Cellular Cardiology. 2016; 93:175-85. [DOI:10.1016/j.yjmcc.2015.11.005] [PMID]
  15. Singh D, Rai V, Agrawal DK. Regulation of collagen i and collagen III in tissue injury and regeneration. Cardiology and Cardiovascular Medicine. 2023; 7(1):5-16. [DOI:10.26502/fccm.92920302] [PMID]
  16. Meschiari CA, Ero OK, Pan H, Finkel T, Lindsey ML. The impact of aging on cardiac extracellular matrix. Geroscience. 2017; 39(1):7-18. [PMID] 
  17. Frangogiannis NG. The extracellular matrix in ischemic and nonischemic heart failure. Circ Res. 2019; 125(1):117-46. [DOI:10.1161/CIRCRESAHA.119.311148] [PMID]
  18. Eser P, Trachsel LD, Marcin T, Herzig D, Freiburghaus I, De Marchi S, et al. Short- and long-term effects of high-intensity interval training vs. moderate-intensity continuous training on left ventricular remodeling in patients early after ST-segment elevation myocardial infarction-The HIIT-EARLY randomized controlled trial. Frontiers in Cardiovascular Medicine. 2022; 9:869501. [DOI:10.3389/fcvm.2022.869501] [PMID]
  19. Zhang S, Zhang J, Liang C, Li X, Meng X. High-intensity interval training for heart failure with preserved ejection fraction: A protocol for systematic review and meta-analysis. Medicine. 2020; 99(27):e21062. [DOI:10.1097/MD.0000000000021062] [PMID]
  20. Du L, Zhang X, Chen K, Ren X, Chen S, He Q. Effect of high-intensity interval training on physical health in coronary artery disease patients: A meta-analysis of randomized controlled trials. Journal of Cardiovascular Development and Disease. 2021; 8(11):158. [DOI:10.3390/jcdd8110158] [PMID]
  21. Besnier F, Labrunée M, Richard L, Faggianelli F, Kerros H, Soukarié L, et al. Short-term effects of a 3-week interval training program on heart rate variability in chronic heart failure. A randomised controlled trial. Annals of physical and Rehabilitation Medicine. 2019; 62(5):321-8. [DOI:10.1016/j.rehab.2019.06.013] [PMID]
Type of Study: Original | Subject: Gross Anatomy
Received: 2021/11/13 | Accepted: 2022/04/20 | Published: 2023/01/1

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.